EGFL6 (NM_015507) Human 3' UTR Clone

SKU
SC206684
3' UTR clone of EGF-like-domain multiple 6 (EGFL6) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol EGFL6
Synonyms MAEG; W80
ACCN NM_015507
Insert Size 510 bp
Sequence Data
Insert Sequence
>SC206684 3’UTR clone of NM_015507
The sequence shown below is from the reference sequence of NM_015507. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGATAGCCTTTTATCTGTGGATGACTGAATGTTACTATCTTTATATTTGACTTTGTATGTCAGTTCC
CTGGTTTTTTTGATATTGCATCATAGGACCTCTGGCATTTTAGAATTACTAGCTGAAAAATTGTAATGT
ACCAACAGAAATATTATTGTAAGATGCCTTTCTTGTATAAGATATGCCAATATTTGCTTTAAATATCAT
ATCACTGTATCTTCTCAGTCATTTCTGAATCTTTCCACATTATATTATAAAATATGGAAATGTCAGTTT
ATCTCCCCTCCTCAGTATATCTGATTTGTATAAGTAAGTTGATGAGCTTCTCTCTACAACATTTCTAGA
AAATAGAAAAAAAAGCACAGAGAAATGTTTAACTGTTTGACTCTTATGATACTTCTTGGAAACTATGAC
ATCAAAGATAGACTTTTGCCTAAGTGGCTTAGCTGGGTCTTTCATAGCCAAACTTGTATATTTAAATTC
TTTGTAATAATAATATCCAAATCATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015507.4
Locus ID 25975
Summary This gene encodes a member of the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily are characterized by the presence of EGF-like repeats and are often involved in the regulation of cell cycle, proliferation, and developmental processes. The gene product contains a signal peptide, suggesting that it is secreted; an EGF repeat region consisting of 4 complete EGF-like repeats and 1 partial EGF-like repeat, 3 of which have a calcium-binding consensus sequence; an arg-gly-asp integrin association motif; and a MAM domain, which is believed to have an adhesive function. This gene is expressed early during development, and its expression has been detected in lung and meningioma tumors. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.