OriGene Logo

TIMM8B (NM_012459) Human 3' UTR Clone

Be the first to review this product
SKU
SC206674
3' UTR clone of translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "TIMM8B or NM_012459"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TIMM8B
Synonyms DDP2; TIM8B
ACCN NM_012459
Insert Size 525 bp
Sequence Data
Insert Sequence
>SC206674 3’UTR clone of NM_012459
The sequence shown below is from the reference sequence of NM_012459. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCAGATTGTACAGAAAGGAGGGCAGTAGGCCATCCCCCAGGAGAATGACAGAAGCAAAGGACTTGTT
ACTAAGCAGATTTAAGGGTCAGTGGGGGAAGGCTATCAACCCATTGTCAGATCAGCATCAGGCTGTTAT
CAAGTCTGTTGGTGCTAAAAAGTAAAAGATGAAATGTTCAAAGAGTGAAATTTATTTATTTGGAATTCA
GAAATTCCAGGTTGTATGACATCAGTTACTCAATAAGTGTGAATTCTCCAACTCTTCTTTTAATCCCAT
TTTAGAATTTAATATAGAGATCTCTGATTGGCAGGAACACTAGAAATAAATGTTCCATGGCCAGTAGTG
CAAATGGGGGATTGTAGGTTTTGAAAAACCACCCTAAGCCATATTAAGGGGGTTGGAAGAACCATCGAA
GCCTAAGGCATAGAAGAAAATTTGGGGTTAAGAAAGATGAAGAACAAAAAACAGCTTTATTGCTTATAC
ATGACCAAGAAAAGGAAAACATGGCAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012459.4
Locus ID 26521
Summary This gene encodes a member of a well-conserved family of proteins with similarity to yeast Tim mitochondrial import proteins. This gene is encoded by a nuclear gene and is transported into the intermembrane space of the mitochondrion. When formed into complexes, these proteins guide membrane-spanning proteins across the mitochondrial intermembrane space before they are added into the mitochondrial inner membrane. This gene is adjacent to succinate dehydrogenase, subunit D (SDHD), in which mutations have been found in affected members of families with hereditary paraganglioma.provided by RefSeq, Aug 2009
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.