BIN1 (NM_139348) Human 3' UTR Clone

CAT#: SC206672

3' UTR clone of bridging integrator 1 (BIN1) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BIN1
• Synonyms: AMPH2; AMPHL; CNM2; SH3P9
• ACCN: NM_139348
• Insert Size: 524 bp
• Sequence Data:
  Insert Sequence

  >SC206672 3’UTR clone of NM_139348
  The sequence shown below is from the reference sequence of NM_139348. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CCCGAGAACTTCACTGAGAGGGTCCCATGACGGCGGGGCCCAGGCAGCCTCCGGGCGTGTGAAGAACAC
  CTCCTCCCGAAAAATGTGTGGTTCTTTTTTTTGTTTTGTTTTCGTTTTTCATCTTTTGAAGAGCAAAGG
  GAAATCAAGAGGAGACCCCCAGGCAGAGGGGCGTTCTCCCAAAGATTAGGTCGTTTTCCAAAGAGCCGC
  GTCCCGGCAAGTCCGGCGGAATTCACCAGTGTTCCTGAAGCTGCTGTGTCCTCTAGTTGAGTTTCTGGC
  GCCCCTGCCTGTGCCCGCATGTGTGCCTGGCCGCAGGGCGGGGCTGGGGGCTGCCGAGCCACCATGCTT
  GCCTGAAGCTTCGGCCGCGCCACCCGGGCAAGGGTCCTCTTTTCCTGGCAGCTGCTGTGGGTGGGGCCC
  AGACACCAGCCTAGCCTGGCTCTGCCCCGCAGACGGTCTGTGTGCTGTTTGAAAATAAATCTTAGTGTT
  CAAAACAAAATGAAACAAAAAAAAAATGATAAAAACTCTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139348.3
• Summary: This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016]
• Locus ID: 274
• MW: 19.6