BRSK1 (NM_032430) Human 3' UTR Clone

SKU
SC206670
3' UTR clone of BR serine/threonine kinase 1 (BRSK1) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BRSK1
Synonyms hSAD1
ACCN NM_032430
Insert Size 524 bp
Sequence Data
Insert Sequence
>SC206670 3’UTR clone of NM_032430
The sequence shown below is from the reference sequence of NM_032430. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGCCACCAACGGGACCCCTCTGCCCTGACCCCACGGGGCCGGGGAGGGAGGGGACCCCCCTCCACCC
CCCTTCCGTGCCCCCCAACTGTGAATCTGTAAATAAGGCCCAAGGAACATGTCGGGAGGGGGGTGGACA
CAAAAACCGGCCTTGCCCTGCAGGGATGGGGCTCCACAGGCCGTGCCCAACTGGGGGTGGTTCTAGGGG
AACAGGGGGCGGGGGAGCTGTTTCTATTTTATTTATTGATTAATTTATTATTTTATTTATTGATCAATC
TCTCTGCGGGGTGGGGTGGGGGAGGGACGGGAGCTGGTTGGGGTGGCTTAGCAGATCCGGACAGGGCCC
TCTGTCCCTGTGTCGTCCCCAACCCCCTCTTCCCGGGCCCCTCCTCCCCTGGTCCTCCCCCCACGACCT
TCTGTACGGATTTGCTCTCCGGAAGGAATTCTGGTTTCGCGTGATCCTGCCTGCGTCCGTGTCTCTGAT
TCCGCCGGCGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032430.2
Locus ID 84446
Summary Serine/threonine-protein kinase that plays a key role in polarization of neurons and centrosome duplication. Phosphorylates CDC25B, CDC25C, MAPT/TAU, RIMS1, TUBG1, TUBG2 and WEE1. Following phosphorylation and activation by STK11/LKB1, acts as a key regulator of polarization of cortical neurons, probably by mediating phosphorylation of microtubule-associated proteins such as MAPT/TAU at 'Thr-529' and 'Ser-579'. Also regulates neuron polarization by mediating phosphorylation of WEE1 at 'Ser-642' in post-mitotic neurons, leading to down-regulate WEE1 activity in polarized neurons. In neurons, localizes to synaptic vesicles and plays a role in neurotransmitter release, possibly by phosphorylating RIMS1. Also acts as a positive regulator of centrosome duplication by mediating phosphorylation of gamma-tubulin (TUBG1 and TUBG2) at 'Ser-131', leading to translocation of gamma-tubulin and its associated proteins to the centrosome. Involved in the UV-induced DNA damage checkpoint response, probably by inhibiting CDK1 activity through phosphorylation and activation of WEE1, and inhibition of CDC25B and CDC25C.[UniProtKB/Swiss-Prot Function]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.