AP2M1 (NM_001025205) Human 3' UTR Clone

SKU
SC206644
3' UTR clone of adaptor-related protein complex 2 mu 1 subunit (AP2M1) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol AP2M1
Synonyms AP50; CLAPM1; MRD60; mu2
ACCN NM_001025205
Insert Size 505 bp
Sequence Data
Insert Sequence
>SC206644 3’UTR clone of NM_001025205
The sequence shown below is from the reference sequence of NM_001025205. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCAGTGGCATTTATGAAACTCGCTGCTAGCTGCCACTAGGCAGCTAGCCCACCTCCCCAGCCACCCTC
CTCCACAGGTCCAGGTGCCGCTCCCTCCCCCACCACACATCAGTGTCTCCTCCCTCCTGCTTTGCTGCC
TTCCCTTTGCACCAGCCCGAGTCTAGGTCTGGGCCAAGCACATTACAAGTGGGACCGGTGGAGCAGCCC
CTGGGCTCCCTGGGCAGGGGAGTTCTGAGGCTCCTGCTCTCCCATCCACCTGTCTGTCCTGGCCTAATG
CCAGGCTCTGAGTTCTGTGACCAAAGCCAGGTGGGTTCCCTTTCCTTCCCACCCCTGTGGCCACAGCTC
TGGAGTGGGAGGGTTGGTTGCCCCTCACCTCAGAGCTCCCCCAAAGGCCAGTAATGGATCCCCGGCCTC
AGTCCCTACTCTGCTTTGGGATAGTGTGAGCTTCATTTTGTACACGTGTGACTTCGTCCAGTTACAAAC
CCAATAAACTCTGTAGAGTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025205.2
Locus ID 1173
Summary This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2015
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.