OriGene Logo

GGCT (NM_024051) Human 3' UTR Clone

Be the first to review this product
SKU
SC206635
3' UTR clone of gamma-glutamyl cyclotransferase (GGCT) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "GGCT or NM_024051"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GGCT
Synonyms C7orf24; CRF21; GCTG; GGC
ACCN NM_024051
Insert Size 501 bp
Sequence Data
Insert Sequence
>SC206635 3’UTR clone of NM_024051
The sequence shown below is from the reference sequence of NM_024051. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCAAAAAGGGGGAAACACAAACTCTTTAGAACATAACAGAATATATCTAAGGGTATTCTATGTGCTAA
TATAAAATATTTTTAACACTTGAGAACAGGGATCTGGGGGATCTCCACGTTTGATCCATTTTCAGCAGT
GCTCTGAAGGAGTATCTTACTTGGGTGATTCCTTGTTTTTAGACTATAAAAAGAAACTGGGATAGGAGT
TAGACAATTTAAAAGGGGTGTATGAGGGCCTGAAATATGTGACAAATGAATGTGAGTACCCCTTCTGTG
AACACTGAAAGCTATTCTCTTGAATTGATCTTAAGTGTCTCCTTGCTCTGGTAAAAGATAGATTTGTAG
CTCACTTGATGATGGTGCTGGTGAATTGCTCTGCTCTGTCTGAGATTTTTAAAAATCAGCTTAATGAGA
GTAATCTGCAGACAATTGATAATAACATTTTGAAAATTGGAAAGATGGTATACTGTTTTTAGAGGAATA
AACGTATTTGTGGTTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024051.4
Locus ID 79017
Summary The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.