OriGene Logo

GABA A Receptor delta (GABRD) (NM_000815) Human 3' UTR Clone

Be the first to review this product
SKU
SC206589
3' UTR clone of gamma-aminobutyric acid (GABA) A receptor delta (GABRD) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "GABA A Receptor delta or NM_000815"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GABA A Receptor delta
Synonyms EIG10; EJM7; GEFSP5
ACCN NM_000815
Insert Size 506 bp
Sequence Data
Insert Sequence
>SC206589 3’UTR clone of NM_000815
The sequence shown below is from the reference sequence of NM_000815. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCATCTACTGGGCGGCATACGCCATGTGAGCACAGGACTCAGGCCACCCTCGCTTGTCCTGGCGCCCG
GCGGCAGCTGCCCAGAAACTTCCTGGGAGAAAGAGCCCTCGGGCTGCCTTCCCCTCTGCGTGTTTCGAA
GTGGGATGACAGTCGGCCACGGAAAACAAGAGGAAGCCTCGGCCTCCCTGAGCTCTGACCCCAGCCTCA
CCCGAAAGGCCAGCCTGGGGCTCTCCGGCAGGCAGCCCGAGACCTGCACAGATGAAGGAGCAGAGGTTC
TGACCGAGAGGCTGAGCCAGGCCGGGGTCTGGGCCCTTCAGGGAGCCGCGGATTTTTATGTTCAGAAAG
TGATCCTGGTTTCTAGGTCTTTGCTCTGCAGGATCGGGATCAGAGCGTGGGAGGAGGTGGGGGTGGACG
TCCATCCGGTGAACAGTGAAGGCGTTTGTGAGGTCTTTCTGGTCCCAGCATGAAATAAAGCCTTGGCCT
GGGGGCCGCTTCATTCTCCCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000815.5
Locus ID 2563
Summary Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.