PTGER3 (NM_198716) Human 3' UTR Clone

SKU
SC206584
3' UTR clone of prostaglandin E receptor 3 (subtype EP3) (PTGER3) transcript variant 6 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PTGER3
Synonyms EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; lnc003875; PGE2-R
ACCN NM_198716
Insert Size 511 bp
Sequence Data
Insert Sequence
>SC206584 3’UTR clone of NM_198716
The sequence shown below is from the reference sequence of NM_198716. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGAGCAAGAGGAATTTTGGGGAAATTAAAACCTGCCTTTCTGCCAGGATCACATCACTGGAAGCTCC
ATGACTCTCTTTTTGTAAAAGAAAAAAAAATCACAGAAACACCCACCTCCCAAACTATTCTCTTTTACT
TCTTCCCCCAAGCCCACCCCCAAATATAACTGTTATCCAGAAGCTGTTATGTCCTGTTTCCATACATGT
TTTTGTACTTTTACTATATCTACATACATCAATTAAACTTATGTCCTATTGTTTTGTGAATTTATATTT
GCGTATACATTATCATATGTAAAATTTGCATTTTTTTATTGAAAATTATGTTTCTTGAGATTTATCCAC
ATTGAAACATGGAGCTCTAAATCGTTAATTTTAACCGCTATAGAGTATTCCATAATTTGAATAAAGCAT
AATTTGTTTGTACAATCTCCCGCCAAGGGAAAATTATTTCCACACTCATCATGACAAGGAGCACTGCAA
AAATAAAAATAAAAATTACATTCATACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198716.2
Locus ID 5733
Summary The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Aug 2009
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.