OriGene Logo

BRCC45 (BRE) (NM_199193) Human 3' UTR Clone

Be the first to review this product
SKU
SC206527
3' UTR clone of brain and reproductive organ-expressed (TNFRSF1A modulator) (BRE) transcript variant 4 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "BRCC45 or NM_199193"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BRCC45
Synonyms BRCC4; BRCC45; BRE
ACCN NM_199193
Insert Size 511 bp
Sequence Data
Insert Sequence
>SC206527 3’UTR clone of NM_199193
The sequence shown below is from the reference sequence of NM_199193. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGATGGGGAGGAATCCAGCTCTGCCTGACATCCAGGCATCCTCTCCAAATTGCATAGGGCTTATTTC
AAAACCTTTGTCCCTCAGTTCCAGGAGGCAGCATTTGCCAATGGAAAGCTCTAGGAAACACCAGTCTTG
AGAGGTGGCCAGCCAGACTGCCTGTCCACATGCGTGTCAGCACATACAGCCGCTTCCTGGAAGCCGCCT
GGAATGTCTTCACGGCAGCGTTTTGCTCACACAGCAGCTTTTGCACGCCCCAGGCAGCCCCGACTGCTG
AAATCCAACTTGAGCTGGCTGGTGGTCCCTGGATCCTAGAGCCCTTCACTTCGGGTTACTCCCTCTTTC
TTGCCTCTATTTCTTAGTTGGAAGAAATAAACTCACAAATTATGGTGCAGTAATTTTCCGGGGAAAGTA
AAGCCTCAGGAATGCCCACGCCTTTCTTCCAAAGCCTTTGTCTCTGAGACCTCTTAAGTTCTAAGATTA
AATGCCCCTCGCTGTTCTTCCTCTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199193.3
Locus ID 9577
Summary This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. provided by RefSeq, Jun 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.