OriGene Logo

PIN1 (NM_006221) Human 3' UTR Clone

Be the first to review this product
SKU
SC206526
3' UTR clone of peptidylprolyl cis/trans isomerase NIMA-interacting 1 (PIN1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "PIN1 or NM_006221"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PIN1
Synonyms DOD; UBL5
ACCN NM_006221
Insert Size 520 bp
Sequence Data
Insert Sequence
>SC206526 3’UTR clone of NM_006221
The sequence shown below is from the reference sequence of NM_006221. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCATCCACATCATCCTCCGCACTGAGTGAGGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGG
CGGCTAGGCCGGCCAGCTCCCCCTTGCCCGCCAGCCAGTGGCCGAACCCCCCACTCCCTGCCACCGTCA
CACAGTATTTATTGTTCCCACAATGGCTGGGAGGGGGCCCTTCCAGATTGGGGGCCCTGGGGTCCCCAC
TCCCTGTCCATCCCCAGTTGGGGCTGCGACCGCCAGATTCTCCCTTAAGGAATTGACTTCAGCAGGGGT
GGGAGGCTCCCAGACCCAGGGCAGTGTGGTGGGAGGGGTGTTCCAAAGAGAAGGCCTGGTCAGCAGAGC
CGCCCCGTGTCCCCCCAGGTGCTGGAGGCAGACTCGAGGGCCGAATTGTTTCTAGTTAGGCCACGCTCC
TCTGTTCAGTCGCAAAGGTGAACACTCATGCGGCCCAGCCATGGGCCCTCTGAGCAACTGTGCAGCACC
CTTTCACCCCCAATTAAACCCAGAACCACTGCTCTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006221.4
Locus ID 5300
Summary Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.provided by RefSeq, Jun 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.