OriGene Logo

SIRT7 (NM_016538) Human 3' UTR Clone

Be the first to review this product
SKU
SC206516
3' UTR clone of sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) (SIRT7) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "SIRT7 or NM_016538"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SIRT7
Synonyms SIR2L7
ACCN NM_016538
Insert Size 507 bp
Sequence Data
Insert Sequence
>SC206516 3’UTR clone of NM_016538
The sequence shown below is from the reference sequence of NM_016538. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACGCACAAAAAGGAAGAAAGTGACGTAATCACGTGCTCGATGAAGAACAGTTGGCACTTTGCAGATG
GCCAGTGTCACGGTGAAGGCTGGGTTGCCCCCACGGGTCTAGGGAGAACGAACTCTTTGGGGATGACAT
TTTCACCGTGACATTTTTAGCCATTTGTCCTTGAGGAAGCCCCTTGCACTGCTGCGGTTGTACCCTGAT
ACGGCCTGGCCATCGAGGACACCTGCCCATCCGGCCTCTGTGTCAAGAGGTGGCAGCCGCACCTTTCTG
TGAGAACGGAACTCGGGTTATTTCAGCCCCGGCCTGCAGAGTGGAAGCGCCCAGCGGCCTTTCCTCGCT
CACCAGGCCAGTCTCAGGGCCTCACCGTATTTCTACTACTACTTAATGAAAAAGTGTGAACTTTATAGA
ATCCTCTCTGTACTGGATGTGCGGCAGAGGGGTGGCTCCGAGCCTCGGCTCTATGCAGACCTTTTTATT
TCTATTAAACGTTTCTGCACTGGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016538.3
Locus ID 51547
Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.