OriGene Logo

MYOM2 (NM_003970) Human 3' UTR Clone

Be the first to review this product
SKU
SC206512
3' UTR clone of myomesin (M-protein) 2 165kDa (MYOM2) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "MYOM2 or NM_003970"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MYOM2
Synonyms TTNAP
ACCN NM_003970
Insert Size 505 bp
Sequence Data
Insert Sequence
>SC206512 3’UTR clone of NM_003970
The sequence shown below is from the reference sequence of NM_003970. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCGCGTCTGCCTCAGCGGCAGGCCAGTGAAGGCGTTTTCCTAGCCTGGAGATGGGAAAATATGCTTGG
CAGAGACAGGAATGCTGTGTGCTTGTTCCAAATGAGCAGCTGGCATCCGAGTGGTGTCCTGTGTGGGCT
GATAGTTGATCACACATTGTGCTTTTGATTTTTGCATTTGGTGATGAATATTTTATACCCGTCTAAGGG
AGAAAGCTAATGTTTTCCACAAGACTGAACAACGTGTATTTACACGAGGGTAGACGGCAGATGCCTGAC
AGAGAGTGGGTTGGCAGACAACACACTAGAATTTTCACGGGTGTGGGCACATGGGTGTGGCACCTGGAC
GTGTGCAGCATGTGGCGGTCTGTGTGAAGCCACCGTGCTTCTCTTTGGGGGGCCGCGAGATCTAGCATC
TCTGAAATCCTGGCTGTCGAGGCTTTGAAGCATGTGTTACCTGGTTAAGCTTGTTTTCTCTTGCTTTAG
GCAAATAAAAGTTTAAAAATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003970.4
Locus ID 9172
Summary The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.