OriGene Logo

Hsp60 (HSPD1) (NM_002156) Human 3' UTR Clone

Be the first to review this product
SKU
SC206500
3' UTR clone of heat shock 60kDa protein 1 (chaperonin) (HSPD1) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Hsp60 or NM_002156"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Hsp60
Synonyms CPN60; GROEL; HLD4; HSP-60; HSP60; HSP65; HuCHA60; SPG13
ACCN NM_002156
Insert Size 492 bp
Sequence Data
Insert Sequence
>SC206500 3’UTR clone of NM_002156
The sequence shown below is from the reference sequence of NM_002156. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGA
CAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAG
GCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCT
GTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATA
CTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATT
CTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGT
GAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTT
TAAAGTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002156.5
Locus ID 3329
Summary This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.