Leptin Receptor (LEPR) (NM_002303) Human 3' UTR Clone

SKU
SC206473
3' UTR clone of leptin receptor (LEPR) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Leptin Receptor
Synonyms CD295; LEP-R; LEPRD; OB-R; OBR
ACCN NM_002303
Insert Size 484 bp
Sequence Data
Insert Sequence
>SC206473 3' UTR clone of NM_002303
The sequence shown below is from the reference sequence of NM_002303. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAAACAAGATGTGTGACCTAACTGTGTAATTTCACTGAAGAAACCTTCAGATTTGTGTTATAATGGGT
AATATAAAGTGTAATAGATTATAGTTGTGGGTGGGAGAGAGAAAAGAAACCAGAGTCAAATTTGAAAATA
ATTGTTCCAAATGAATGTTGTCTGTTTGTTCTCTCTTAGTAACATAGACAAAAAATTTGAGAAAGCCTTC
ATAAGCCTACCAATGTAGACACGCTCTTCTATTTTATTCCCAAGCTCTAGTGGGAAGGTCCCTTGTTTCC
AGCTAGAAATAAGCCCAACAGACACCATCTTTTGTGAGATGTAATTGTTTTTTCAGAGGGCGTGTTGTTT
TACCTCAAGTTTTTGTTTTGTACCAACACACACACACACACACATTCTTAACACATGTCCTTGTGTGTTT
TGAGAGTATATTATGTATTTATATTTTGTGCTATCAGACTGTAGGATTTGAAGTAGGACTTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002303.4
Locus ID 3953
Summary The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.