OriGene Logo

NOB1 (NM_014062) Human 3' UTR Clone

Be the first to review this product
SKU
SC206463
3' UTR clone of NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) (NOB1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "NOB1 or NM_014062"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol NOB1
Synonyms ART-4; MST158; MSTP158; NOB1P; PSMD8BP1
ACCN NM_014062
Insert Size 491 bp
Sequence Data
Insert Sequence
>SC206463 3’UTR clone of NM_014062
The sequence shown below is from the reference sequence of NM_014062. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGAAAGAAGTTTGTGAAGAAAAGGTGAAGAGCGAGTTCCCGCAGGCAAATTGGATGGGCGTCTGGC
CGCCGTGGAGTTCCGGTGACCCATTTCCCCAGCCGTGTCGTCTCCAGGACCACCCGATGGAAATAACAG
GCGGGCTTCACGGTGCGGCTCTGTCCGCCCATGCCCCGCTGGGTCTGCAGGGAACTGGACTGTCCCATG
GCCTGTGAGCACCGGAGCGCCTGGCTGCCTGCCAAGGAAGTGCAATTGCATAAAAACAGAAAGAACAAC
GCCCTGGAGCCAATCTTCAAGAAAGGAATTTCCAAAGGATAATATTTTTCTAATAAATGCGGCTGCAAC
CTCCTGTGCATTTAATTAAATAGGCCAAATTTTTGCTGCTTAGGTCATCTCAAGGCTGATACTTGAGCT
GTGTGCCCAGAGATCATGCATTTAGATTTATATTTTTGCCAGAAAATACAAGGTTATAATAAAACTAAG
AACTACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014062.3
Locus ID 28987
Summary In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 PubMed 19706509).supplied by OMIM, Nov 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.