OriGene Logo

TRADD (NM_003789) Human 3' UTR Clone

Be the first to review this product
SKU
SC206459
3' UTR clone of TNFRSF1A-associated via death domain (TRADD) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "TRADD or NM_003789"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TRADD
Synonyms Hs.89862
ACCN NM_003789
Insert Size 494 bp
Sequence Data
Insert Sequence
>SC206459 3’UTR clone of NM_003789
The sequence shown below is from the reference sequence of NM_003789. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGACCGATCCCAATGGCGGCCTGGCCTAGACCAGGGGTGCAGCCAGCTTTTGGAGAACCTGGATGGCC
TTAGGGTTCCTTCTGCGGCTATTGCTGAACCCCTGTCCATCCACGGGACCCTGAAACTCCACTTGGCCT
ATCTGCTGGACCTGCTGGGGCAGAGTTGATTGCCTTCCCCAGGAGCCAGACCACTGGGGGTGCATCATT
GGGGATTCTGCCTCAGGTACTTTGATAGAGTGTGGGGTGGGGGGGACCTGCTTTGGAGATCAGCCTCAC
CTTCTCCCATCCCAGAAGCGGGGCTTACAGCCAGCCCTTACAGTTTCACTCATGAAGCACCTTGATCTT
TGGTGTCCTGGACTTCATCCTGGGTGCTGCAGATACTGCAGTGAAGTAAAACAGGAATCAATCTTGCCT
GCCCCCAGCTCACACTCAGCGTGGGACCCCGAATGTTAAGCAATGATAATAAAGTATAACACGGATTTT
GATGTGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003789.4
Locus ID 8717
Summary The protein encoded by this gene is a death domain containing adaptor molecule that interacts with TNFRSF1A/TNFR1 and mediates programmed cell death signaling and NF-kappaB activation. This protein binds adaptor protein TRAF2, reduces the recruitment of inhibitor-of-apoptosis proteins (IAPs) by TRAF2, and thus suppresses TRAF2 mediated apoptosis. This protein can also interact with receptor TNFRSF6/FAS and adaptor protein FADD/MORT1, and is involved in the Fas-induced cell death pathway. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.