WIBG (PYM1) (NM_032345) Human 3' UTR Clone

SKU
SC206453
3' UTR clone of within bgcn homolog (Drosophila) (WIBG) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol WIBG
Synonyms PYM; WIBG
ACCN NM_032345
Insert Size 489 bp
Sequence Data
Insert Sequence
>SC206453 3’UTR clone of NM_032345
The sequence shown below is from the reference sequence of NM_032345. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTTAGAGGACTTGGAGTTAGGCCTCTGAGGCCTTTGGGGAATAGGGAATGGACTGCAGAACAAACCG
TGGGGCTCTCTGGGGTCTGGGGGAATACGGGCAACAGCAGTCAGGAGGGGTACCCCCCATACTGGCTTA
CTTCCACCTCCTGCGGCCCAGCTCTGTCCTCCAGAGCCTAGCGTCTCCCTCAATCCTTCCCTTTTCTTC
CCAACTTCTACTTTTTGGACTTTCCCCCTCCCATTCCCAGTGTTCAAAATCTCAGTGACTACCCCAGGT
ACCTTTGCTGCTGATTTGGGTGTCTTGTTTAAAAGAAAATCAGGTGGGTGGGAATCTCTTGGAGAACTG
AGGCTGAGGGTAGAGGGAGTATGCCCAAGTCTTGGAGTCTTGGTTCCTGTTCGCGGTGTTTATGGGTTA
TTTCCCTCTCCATCCCTCATTTTTTTTTTTTTTTTAAAAAAAGCAAAAATGAGAATAAACACAAGTAGA
CATGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032345.3
Locus ID 84305
Summary Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.