OriGene Logo

PAX3 (NM_000438) Human 3' UTR Clone

Be the first to review this product
SKU
SC206413
3' UTR clone of paired box 3 (PAX3) transcript variant PAX3A for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "PAX3 or NM_000438"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PAX3
Synonyms CDHS; HUP2; WS1; WS3
ACCN NM_000438
Insert Size 500 bp
Sequence Data
Insert Sequence
>SC206413 3’UTR clone of NM_000438
The sequence shown below is from the reference sequence of NM_000438. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGTGACTTGGAGGGCATCGGCTAGCTGACATTGGTGATCTGACGGCAGCCAAGCCCAGCTCGGATCA
AGGTCCCTTCATGCGCGGTGTCTCTGCGCCTGAGTAACGACATGGAACTGAAAGACCAGAGGGACACTA
GGAATCAAAACAAACATTTCTATTCTGCTTAGTTTTTCTGTTTTGTAAATCTTTCTTTCTTAACCACTT
TCAGCCCCTGGGATTCTAGAACTGTGAATTGTGCTCTGTTGTAGGGGGCAGGGGAAGCTCTCACTCTGT
TGCCATTAAATGTATGAGACTGGGCATCTCTGAGCAATTGTAGGGCCGGGGATAGAGGGTACTTGAATC
TTCAGAAGTTGAAGTAGCTTTTATGCCCTCAGGAAAGGCCCTGGTCTCCGGAGTTTCCTCGCATTAAAG
GAGAGAGAGAGAGAGTACTCTTTTGGGCAACGGCCCTCCAAAATTGCCCCCACATTGGCTGCCTTATAA
ATATGTCTGTGTGTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000438.6
Locus ID 5077
Summary This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.