Nephrocystin 4 (NPHP4) (NM_015102) Human 3' UTR Clone

Be the first to review this product
SKU
SC206401
3' UTR clone of nephronophthisis 4 (NPHP4) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Nephrocystin 4 or NM_015102"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Nephrocystin 4
Synonyms POC10; SLSN4
ACCN NM_015102
Insert Size 484 bp
Sequence Data
Insert Sequence
>SC206401 3’UTR clone of NM_015102
The sequence shown below is from the reference sequence of NM_015102. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCATTTTGCGTGAAGGTCATCTACCAGTGAGGGCTTGAGGGTGACGTCCTTCCTGCGGCACCCAGCTGG
GGCCTGTCTGTGCCCCTCCTGCCCTGCAGGCTGTCCTCCCCGCCTCTCTGCAGCCTTTCACTTCAGTGC
CCACCTGGCTGACCTGTGCACTTGGCTGAGGAAGCAGAGACCGAGCGCTGGTCATTTTGTAGTACCTGC
ATCCAGCTTAGCTGCTGCTGACACCCAGCAGGCCTGGGTTCCGTGAGCGCGAACTCCGTGGTGGTGGGT
CTGGCTCTGGTGCTGCCATCTACGCATGTGGGACCCTCGTTATCGCTGTTGCTCAAAATGTATTTTATG
AATCATCCTAAATGAGAAAATTATGTTTTTCTTACTGGATTTTGTACAAACATAATCTATTATTTGCTA
TGCAATATTTTATGCTGGTATTATATCTGTTTTTTAAATTGTTGAACAAAATACTAAACTTTTACACGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015102.5
Locus ID 261734
Summary This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.