OriGene Logo

SPDEF (NM_012391) Human 3' UTR Clone

Be the first to review this product
SKU
SC206381
3' UTR clone of SAM pointed domain containing ets transcription factor (SPDEF) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "SPDEF or NM_012391"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SPDEF
Synonyms bA375E1.3; PDEF
ACCN NM_012391
Insert Size 502 bp
Sequence Data
Insert Sequence
>SC206381 3’UTR clone of NM_012391
The sequence shown below is from the reference sequence of NM_012391. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCGTCTACCAGTTCGTGCACCCCATCTGAGTGCCTGGCCCAGGGCCTGAAACCCGCCCTCAGGGGCCT
CTCTCCTGCCTGCCCTGCCTCAGCCAGGCCCTGAGATGGGGGAAAACGGGCAGTCTGCTCTGCTGCTCT
GACCTTCCAGAGCCCAAGGTCAGGGAGGGGCAACCAACTGCCCCAGGGGGATATGGGTCCTCTGGGGCC
TTCGGGACCCTGGGGCAGGGGTGCTTCCTCCTCAGGCCCAGCTGCTCCCCTGGAGGACAGAGGGAGACA
GGGCTGCTCCCCAACACCTGCCTCTGACCCCAGCATTTCCAGAGCAGAGCCTACAGAAGGGCAGTGACT
CGACAAAGGCCACAGGCAGTCCAGGCCTCTCTCTGCTCCATCCCCCTGCCTCCCATTCTGCACCACACC
TGGCATGGTGCAGGGAGACATCTGCACCCCTGAGTTGGGCAGCCAGGAGTGCCCCCGGGAATGGATAAT
AAAGATACTAGAGAACTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012391.3
Locus ID 25803
Summary The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.