OriGene Logo

Inversin (INVS) (NM_183245) Human 3' UTR Clone

Be the first to review this product
SKU
SC206372
3' UTR clone of inversin (INVS) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Inversin or NM_183245"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Inversin
Synonyms INV; NPH2; NPHP2
ACCN NM_183245
Insert Size 500 bp
Sequence Data
Insert Sequence
>SC206372 3’UTR clone of NM_183245
The sequence shown below is from the reference sequence of NM_183245. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTCAGCCAAAAAACAAAACAAAACCTTGACTGCCTATGGAGGAAGACTGTGTTCGGGGGAGCTGGCAT
AGCTAGTGCAGAGTTCAGATTTTCTGCTGATAATCTTTTACACCTTGGGAAAACTTTAATATCCGTACC
TGAAGGCTGATTCACCTAAAAATGTGTTAACTGAAAGAAAATGTCAGAATGTTTCCTTTCTGCTCTTAC
ACAGCATTGTTTTGTCAATCAACACAGCCTGCACTGAAAGGACCTGCATAGACTATGTCTGTGCAAAGT
GCCTGAGTGTCTGCTTTCACCTCAGTCTGTACAGTTGGAAATGAGAATTCATAATTAACAGCAAAATCT
AAGGAAAACTACGGCTGCTGGGTTGGGATTTCTGCCAGCTAGCTGGTACTGGCTTCTTGTTTCAAGAGA
TGAACCTAAATGAGATAGGAAGCCTGTCCCATAGCAGCCTTCCTCTCACTACTTTCCTGGCATCTAATG
CAACAAACTTATCACAC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_183245.2
Locus ID 27130
Summary This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. provided by RefSeq, May 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.