GSTM4 (NM_147148) Human 3' UTR Clone

SKU
SC206369
3' UTR clone of glutathione S-transferase mu 4 (GSTM4) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GSTM4
Synonyms GSTM4-4; GTM4
ACCN NM_147148
Insert Size 496 bp
Sequence Data
Insert Sequence
>SC206369 3’UTR clone of NM_147148
The sequence shown below is from the reference sequence of NM_147148. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTTTGAGGTTTCCTGTGGCATAATGTGATGGTCAATTTTCTGCATCAACTTGACTGGGCTAAGGGAT
GCTCAGATGGCAGGTAAAATCATTGTGCTTGTGAGGGTGTTTCCAGAAGAGATTTGCCTTTGAATCAGA
AGACAGCAAAGATTTCCTTCAGCAATGAAGGAGGCATCCACCAAACTGTCAGGGCCCAGAGAGAAGAAA
AAGACAGGAAGGGTGAATTTGACCTCTCTGACTGGGACATCCATCTCTGCCTATCCTGGGACCTCCACA
CTCCTGGTTCTCTGGCCTTCAGACTTGATCAGGGACTAACACCATCGCCTCCCACCCCCACCTTTGTTC
TGAGGCCTTTAGCCTCTGAATGATACCACTGGCTTTCCTGCTTCTCTATCCTGCAGTCGGCAGATCATG
GGACTTCTTCACTCCAAAATTGTGTGAGCCAATTCCCATAACAGATAGATAAATTTATAAATAAACACA
CAAATTTCCTACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_147148.3
Locus ID 2948
Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.