OriGene Logo

ENPP3 (NM_005021) Human 3' UTR Clone

Be the first to review this product
SKU
SC206355
3' UTR clone of ectonucleotide pyrophosphatase/phosphodiesterase 3 (ENPP3) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "ENPP3 or NM_005021"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ENPP3
Synonyms B10; CD203c; NPP3; PD-IBETA; PDNP3
ACCN NM_005021
Insert Size 484 bp
Sequence Data
Insert Sequence
>SC206355 3’UTR clone of NM_005021
The sequence shown below is from the reference sequence of NM_005021. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATTTACCAACATTTGAAACCACTATTTAACTTAATAATGTCTACTTAATATATAATTTACTGTATAAA
GTAATTTTGGCAAAATATAAGTGATTTTTTTCTGGAGAATTGTAAAATAAAGTTTTCTATTTTTCCTTA
AGTCCCCTAAAAGCCATAATTTTTATTATTCCTTTTTCTCTTTTTTCAATTCTATGAATATGTATTATT
TTAAAGTTATATTTTTCACACAGAGATGATGCTATATTACACCTTCCCTTTTTTGTTGGTTTCTTAAAC
TCTAATCTCATGACAGATTATACCTTCCTTATTACTTGTTTTATCTTACTCAGAATCTTTGAATATATT
TTTCTGCCCAGAATTATCTAAACAAAAGGGAGAACAAAAGAAGTATGTCTCACTTGGGAACTGAATCAA
CTCTAAATCAGTTTTGTCACAAAACTTTTTGTATTTGACTGGCAATGCTGATTAAAATTAAAAATGCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005021.5
Locus ID 5169
Summary The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. provided by RefSeq, Oct 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.