KIR2.3 (KCNJ4) (NM_152868) Human 3' UTR Clone

SKU
SC206334
3' UTR clone of potassium inwardly-rectifying channel subfamily J member 4 (KCNJ4) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol KIR2.3
Synonyms HIR; HIRK2; HRK1; IRK-3; IRK3; Kir2.3
ACCN NM_152868
Insert Size 498 bp
Sequence Data
Insert Sequence
>SC206334 3’UTR clone of NM_152868
The sequence shown below is from the reference sequence of NM_152868. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCTCCTACCGCAGGGAGTCTGCCATCTGACCTCCAGGCCCGGCCCTCACCACTGCCCACAAGAGCCTC
TGCCGGGGGTGGGATGCCAGGACACCCCCTCCCACACTCAGGACAGAGCCAACCCTGGCTCCGTGGACC
TTCTGGAGGAAGGTGGGGGTTTCAAAGACTGGGGGACCCCTTCCTCCTGACTCCAGCACCCAGGCCTGG
GAAGAGCTCGGCCCCGATCAGCCTGAGTTCCGCCAGCGCCTACTTCTGGTGGCTCTAGGTCCCCGGATC
CACCACCCTTCCCCCACTGACTCTTCAAGGACGTGCCCTCTTTGCTCTCAGAACCTTGGGGAAGGTGGC
TGGACTGCTGGGCGGGGGACATCTCGGGGTTTCAGGGTGGGCAGGGGGTTAGTTTGGGGAGGGGGGGGT
GCGTTTCTTTTGCATGACTGTGGCCTGTTGCTCATGACTTTCTTTTGTAAATATCTATAAATGGAGACA
GATGGAGACACCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152868.3
Locus ID 3761
Summary Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.