OriGene Logo

IL12A (NM_000882) Human 3' UTR Clone

Be the first to review this product
SKU
SC206305
3' UTR clone of interleukin 12A (natural killer cell stimulatory factor 1 cytotoxic lymphocyte maturation factor 1 p35) (IL12A) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "IL12A or NM_000882"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol IL12A
Synonyms CLMF; IL-12A; NFSK; NKSF1; P35
ACCN NM_000882
Insert Size 490 bp
Sequence Data
Insert Sequence
>SC206305 3’UTR clone of NM_000882
The sequence shown below is from the reference sequence of NM_000882. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGTGATGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCATTTTTATAAAA
CTTTGAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGGGGGAAAGAAGGATGGGACTA
TTACATCCACATGATACCTCTGATCAAGTATTTTTGACATTTACTGTGGATAAATTGTTTTTAAGTTTT
CATGAATGAATTGCTAAGAAGGGAAAATATCCATCCTGAAGGTGTTTTTCATTCACTTTAATAGAAGGG
CAAATATTTATAAGCTATTTCTGTACCAAAGTGTTTGTGGAAACAAACATGTAAGCATAACTTATTTTA
AAATATTTATTTATATAACTTGGTAATCATGAAAGCATCTGAGCTAACTTATATTTATTTATGTTATAT
TTATTAAATTATTTATCAAGTGTATTTGAAAAATATTTTTAAGTGTTCTAAAAATAAAAGTATTGAATT
AAAGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000882.4
Locus ID 3592
Summary This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.