EIF4G1 (NM_182917) Human 3' UTR Clone

SKU
SC206287
3' UTR clone of eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol EIF4G1
Synonyms EIF-4G1; EIF4F; EIF4G; EIF4GI; P220; PARK18
ACCN NM_182917
Insert Size 497 bp
Sequence Data
Insert Sequence
>SC206287 3’UTR clone of NM_182917
The sequence shown below is from the reference sequence of NM_182917. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGCAGAGGAGGAGTCTGACCACAACTGAGGGCTGGTGGGGCCGGGGACCTGGAGCCCCATGGACACA
CAGATGGCCCGGCTAGCCGCCTGGACTGCAGGGGGGCGGCAGCAGCGGCGGTGGCAGTGGGTGCCTGTA
GTGTGATGTGTCTGAACTAATAAAGTGGCTGAAGAGGCAGGATGGCTTGGGGCTGCCTGGGCCCCCCTC
CAGGATGCCGCCAGGTGTCCCTCTCCTCCCCCTGGGGCACAGAGATATATTATATATAAAGTCTTGAAA
TTTGGTGTGTCTTGGGGTGGGGAGGGGCACCAACGCCTGCCCCTGGGGTCCTTTTTTTTATTTTCTGAA
AATCACTCTCGGGACTGCCGTCCTCGCTGCTGGGGGCATATGCCCCAGCCCCTGTACCACCCCTGCTGT
TGCCTGGGCAGGGGGAAGGGGGGGCACGGTGCCTGTAATTATTAAACATGAATTCAATTAAGCTCAAAA
AAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182917.4
Locus ID 1981
Summary The protein encoded by this gene is a component of the multi-subunit protein complex EIF4F. This complex facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. The recognition of the mRNA cap and the ATP-dependent unwinding of 5'-terminal secondary structure is catalyzed by factors in this complex. The subunit encoded by this gene is a large scaffolding protein that contains binding sites for other members of the EIF4F complex. A domain at its N-terminus can also interact with the poly(A)-binding protein, which may mediate the circularization of mRNA during translation. Alternative splicing results in multiple transcript variants, some of which are derived from alternative promoter usage. provided by RefSeq, Aug 2010
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.