OriGene Logo

Endonuclease V (ENDOV) (NM_001164638) Human 3' UTR Clone

Be the first to review this product
SKU
SC206273
3' UTR clone of hypothetical protein FLJ35220 (FLJ35220) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Endonuclease V or NM_001164638"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Endonuclease V
ACCN NM_001164638
Insert Size 450 bp
Sequence Data
Insert Sequence
>SC206273 3’UTR clone of NM_001164638
The sequence shown below is from the reference sequence of NM_001164638. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGAGCAGGCGGGCAAGGACTGGCAGTAGGGTGGAACTGGGCACCATGAAGACAAGAAGGCCACCGGC
CACCCCGTTCTGGCCTCAGGACACTGACCACCCCTGGGGGTGGTCTAGGGACTTAGGGGAACCTCATCT
CAGCCGCAGGTGGAGCACCCAGTCCCCAAAGACAGGCTGACCGCACCACCCCAGGGGGACGCCGCAGCA
CAGCCCAGCACCAGGTGGGGCAGAGGTGACCACGGCCCCTCTTTGCTCCGTCATCGGCTGGTCAGCTGT
GGTCACGGTGCCTCAGAGGACAGATCTCTATGGGGGCAAGTGCCAGATCCTGAGAGCGCATGAGACGCT
TTCCCGGAGCCGACGAAGGGGACTCGGAGCTGCAGCCTGCACGACCCCTGCAGCCTGTGCTTTGCCCAC
CCCTTTCAATAGATGGAACTTGCTTGCTCTTTTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164638.3
Locus ID 284131
Summary Endoribonuclease that specifically cleaves inosine-containing RNAs: cleaves RNA at the second phosphodiester bond 3' to inosine. Has strong preference for single-stranded RNAs (ssRNAs) toward double-stranded RNAs (dsRNAs). Cleaves mRNAs and tRNAs containing inosine. Also able to cleave structure-specific dsRNA substrates containing the specific sites 5'-IIUI-3' and 5'-UIUU-3'. Inosine is present in a number of RNAs following editing; the function of inosine-specific endoribonuclease is still unclear: it could either play a regulatory role in edited RNAs, or be involved in antiviral response by removing the hyperedited long viral dsRNA genome that has undergone A-to-I editing. Binds branched DNA structures.[UniProtKB/Swiss-Prot Function]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.