TIE1 (NM_005424) Human 3' UTR Clone

SKU
SC206266
3' UTR clone of tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (TIE1) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TIE1
Synonyms JTK14; LMPHM11; TIE
ACCN NM_005424
Insert Size 416 bp
Sequence Data
Insert Sequence
>SC206266 3’UTR clone of NM_005424
The sequence shown below is from the reference sequence of NM_005424. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCATTGATGCCACAGCTGAGGAGGCCTGAGCTGCCATCCAGCCAGAACGTGGCTCTGCTGGCCGGAGC
AAACTCTGCTGTCTAACCTGTGACCAGTCTGACCCTTACAGCCTCTGACTTAAGCTGCCTCAAGGAATT
TTTTTAACTTAAGGGAGAAAAAAAGGGATCTGGGGATGGGGTGGGCTTAGGGGAACTGGGTTCCCATGC
TTTGTAGGTGTCTCATAGCTATCCTGGGCATCCTTCTTTCTAGTTCAGCTGCCCCACAGGTGTGTTTCC
CATCCCACTGCTCCCCCAACACAAACCCCCACTCCAGCTCCTTCGCTTAAGCCAGCACTCACACCACTA
ACATGCCCTGTTCAGCTACTCCCACTCCCGGCCTGTCATTCAGAAAAAAATAAATGTTCTAATAAGCTC
CA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005424.5
Locus ID 7075
Summary This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. provided by RefSeq, Nov 2011
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.