FGFR4 (NM_002011) Human 3' UTR Clone

SKU
SC206264
3' UTR clone of fibroblast growth factor receptor 4 (FGFR4) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol FGFR4
Synonyms CD334; JTK2; TKF
ACCN NM_002011
Insert Size 498 bp
Sequence Data
Insert Sequence
>SC206264 3’UTR clone of NM_002011
The sequence shown below is from the reference sequence of NM_002011. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCCCTTCGGGTCTGGGGTGCAGACATGAGCAAGGCTCAAGGCTGTGCAGGCACATAGGCTGGTGGCC
TTGGGCCTTGGGGCTCAGCCACAGCCTGACACAGTGCTCGACCTTGATAGCATGGGGCCCCTGGCCCAG
AGTTGCTGTGCCGTGTCCAAGGGCCGTGCCCTTGCCCTTGGAGCTGCCGTGCCTGTGTCCTGATGGCCC
AAATGTCAGGGTTCTGCTCGGCTTCTTGGACCTTGGCGCTTAGTCCCCATCCCGGGTTTGGCTGAGCCT
GGCTGGAGAGCTGCTATGCTAAACCTCCTGCCTCCCAATACCAGCAGGAGGTTCTGGGCCTCTGAACCC
CCTTTCCCCACACCTCCCCCTGCTGCTGCTGCCCCAGCGTCTTGACGGGAGCATTGGCCCCTGAGCCCA
GAGAAGCTGGAAGCCTGCCGAAAACAGGAGCAAATGGCGTTTTATAAATTATTTTTTTGAAATAAAGCT
CTGTGTGCCTGGGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002011.5
Locus ID 2264
Summary The protein encoded by this gene is a tyrosine kinase and cell surface receptor for fibroblast growth factors. The encoded protein is involved in the regulation of several pathways, including cell proliferation, cell differentiation, cell migration, lipid metabolism, bile acid biosynthesis, vitamin D metabolism, glucose uptake, and phosphate homeostasis. This protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. [provided by RefSeq, Aug 2017]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.