DUSP11 (NM_003584) Human 3' UTR Clone

SKU
SC206240
3' UTR clone of dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) (DUSP11) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DUSP11
Synonyms PIR1
ACCN NM_003584
Insert Size 478 bp
Sequence Data
Insert Sequence
>SC206240 3’UTR clone of NM_003584
The sequence shown below is from the reference sequence of NM_003584. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATCCAGCCTGTTGGGAATGGACCCAGTGATACAAACCTGTCCTGGAATTCTACCTGGAGACCAGAGCT
GGCCTGAAAATTACTGGTGTGACTTTTAATTAGTTCAGGTCTAATCAGGTTTCTTTATTGTTCCCTTAT
GTATTCAAGCTTAAGGAAAAATTGCATTGCTGTTTACCTCTTTGCTGATAAATTTGCAGTAATTACAGC
ATTGCAGGAAAAACAATCTGTTATTCCAGTCTTAAATTTTTCTAAAAGAAGACAATATTTTAGAACTGA
AGCATTGAGAACTTCCCTTGCAAATTATTTTTAAAATTCTATCTTGTTTTTCTATGTATTTCTTTCTGA
CTAGACTTGTGATATGCGTGTGTTTATGTACAGAAATTTTTAGTGTTTTTGTTATGTTCTGTTATTGAC
CCAAAGGCCATCTTTATTTTCTATAACTGTTCAAAATTTATATTAAAATCTACTTAGGAGATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003584.3
Locus ID 8446
Summary The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. provided by RefSeq, Sep 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.