LIMS1 (NM_004987) Human 3' UTR Clone

SKU
SC206234
3' UTR clone of LIM and senescent cell antigen-like domains 1 (LIMS1) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol LIMS1
Synonyms PINCH; PINCH-1; PINCH1
ACCN NM_004987
Insert Size 442 bp
Sequence Data
Insert Sequence
>SC206234 3' UTR clone of NM_004987
The sequence shown below is from the reference sequence of NM_004987. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTAGCTGAGACCTTAGGAAGGAAATAAGTTCCTTTATTTTTTCTTTTCTATGCAAGATAAGAGATTACCA
ACATTACTTGTCTTGATCTACCCATATTTAAAGCTATATCTCAAAGCAGTTGAGAGAAGAGGACCTATAT
GAATGGTTTTATGTCATTTTTTTAATTAAAAAAGAAAAATTCATATAATCGTGTTTAAAACACAAATGAA
GTCAGTATTTGCCTTTGTTAACCCTTATCCATTTGTTGACATGTAGACTGTTTACAAAAAAAAAACACAT
GGTTAAATGTTAAATTTTAATTAAGGCCCCCAAAAATTAAATATAACTTTTTAAAATGAAAGGAGTCACC
TTTTACATGACTCAGGTGAAAAAACAGTATAAACATTAATTTACTTTGTGTTCAAAAGAAAATTCCAACT
GCTGTTGGGGAAGGACACAGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004987.3
Locus ID 3987
Summary The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.