Nephronophthisis (NPHP1) (NM_001128179) Human 3' UTR Clone

SKU
SC206227
3' UTR clone of nephronophthisis 1 (juvenile) (NPHP1) transcript variant 4 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Nephronophthisis
Synonyms JBTS4; NPH1; SLSN1
ACCN NM_001128179
Insert Size 473 bp
Sequence Data
Insert Sequence
>SC206227 3’UTR clone of NM_001128179
The sequence shown below is from the reference sequence of NM_001128179. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGGTGAAATGAGAAAGAATGCAGTGTGACAGTGGCAGCCTCTAGCCCTCAGCTTCCCACGGAATCAG
ATGGATCCTCCACGATTACGTGAATAAAATGATGGAACCAAAAATCACTGTCACTTTACAACTTAGGTT
TTACTCTTTTCTTTCTACAGACCATATTTTTAAAGAAATGTTTATACAATAATTTAAATATTTTTTAAA
ACCATAAAATAAATTTTTATAAGGAATACTGTTATATCTAAATTTAAACAGTATTTATTTTTTCAAAAA
CAGCTACTTAAGTTAATGGTATAGATTTCTATAAAAGCAAGATTTTGTCAAAAACTAAATTTATGATTA
TTCAAGAAAGTGAAAAAAACAACCTACAGAATGGGAAAACATATTTGCAAATCATCTAACTGATAAAGG
TCTAGTATCCAAAATATTTAAATTTATGAGTGTTAATAAAATTTATCTTGTTCAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128179.3
Locus ID 4867
Summary This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.