OriGene Logo

Gemin 4 (GEMIN4) (NM_015721) Human 3' UTR Clone

Be the first to review this product
SKU
SC206223
3' UTR clone of gem (nuclear organelle) associated protein 4 (GEMIN4) for miRNA target validation
  $683.00
5 Days*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Gemin 4 or NM_015721"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Gemin 4
Synonyms HC56; HCAP1; HHRF-1; NEDMCR; p97
ACCN NM_015721
Insert Size 475 bp
Sequence Data
Insert Sequence
>SC206223 3’UTR clone of NM_015721
The sequence shown below is from the reference sequence of NM_015721. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCCTGTTGCAGAAGATGAGCAGCTTCTGACTTGGCGTGGGGAGCTGGGCCCCAACATGGCGGGTCTGC
AGAAGATCAGCAGCTTCTTACCTGTGCGGGAGCGAAAAAGCTGGGCTTCAACATGGCAGGTCTGTAGGG
GTCAGACCCGAGCAGCCTGGACTTTACAGTTATGTGAAACTGTCCACAAAAAGTCATGGCAATAATGGT
GTAAAGAAAATAGTTTCTTGGGTATTTGTAACGTACAAACTATCATAAAAATTCTCCTCTTTCGCATCT
CACTTTGTCTCTTCTAAGTCGGCCTCAGCAATAGCCCAGGATTAAATATGCTCTGAAATTGGGTTTAGT
GTCTTCAAGATCAAATCCAGCCAGGAGGAACATGTTCATAACTGGACTTTTCCATCCTAGATTTTGGCA
AATAAGCCCAAAGTTGAAACCATGTGAGTGGAAAAAGCATTACATGGTACGTATAACCCCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015721.3
Locus ID 50628
Summary The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.