OriGene Logo

VNN2 (NM_004665) Human 3' UTR Clone

Be the first to review this product
SKU
SC206208
3' UTR clone of vanin 2 (VNN2) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "VNN2 or NM_004665"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol VNN2
Synonyms FOAP-4; GPI-80
ACCN NM_004665
Insert Size 460 bp
Sequence Data
Insert Sequence
>SC206208 3’UTR clone of NM_004665
The sequence shown below is from the reference sequence of NM_004665. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAGCTTTGCAAAATATTGTAATGTTATAGGGCGTCTCTTTATCACTCAGCTTCTGCATCATATGCTTG
GCTGAATGTGTTTATCGGCTTCCCAAGTTTACTAAGAAACTTTGAAGGGCTATTTCAGTAGTATAGACC
AGTGAGTCCTAAATATTTTTTCTCATCAATAATTATTTTTTAAGTATTATGATAATGTTGTCCATTTTT
TTGGCTACTCTGAAATGTTGCAGTGTGGAACAATGGAAAGAGCCTGGGTGTTTGGGTCAGATAAATGAA
GATCAAACTCCAGCTCCAGCCTCATTTGCTTGAGACTTTGTGTGTATGGGGGACTTGTATGTATGGGAG
TGAGGAGTTTCAGGGCCATTGCAAACATAGCTGTGCCCTTGAAGAGAATAGTAATGATGGGAATTTAGA
GGTTTATGACTGAATTCCCTTTGACATTAAAGACTATTTGAATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004665.6
Locus ID 8875
Summary This gene product is a member of the Vanin family of proteins that share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. The encoded protein is a GPI-anchored cell surface molecule that plays a role in transendothelial migration of neutrophils. This gene lies in close proximity to, and in same transcriptional orientation as two other vanin genes on chromosome 6q23-q24. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. provided by RefSeq, May 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.