OriGene Logo

RTEL1 (NM_016434) Human 3' UTR Clone

Be the first to review this product
SKU
SC206192
3' UTR clone of regulator of telomere elongation helicase 1 (RTEL1) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "RTEL1 or NM_016434"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RTEL1
Synonyms C20orf41; DKCA4; DKCB5; NHL; PFBMFT3; RTEL
ACCN NM_016434
Insert Size 490 bp
Sequence Data
Insert Sequence
>SC206192 3’UTR clone of NM_016434
The sequence shown below is from the reference sequence of NM_016434. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCCTGCAGCATCTGAGTGGGGCCTCTAGGATGTGCCCAGCCTGCCACACCGCCTCCAGGAAGCAGAG
CGTCATGCAGGTCTTCTGGCCAGAGCCCCAGTGAGTGCCCACGGAGGCCCCCAGCACACCCAACGTGGC
TTGATCACCTGCCTGTCCAGCTCTGGTGGGCCAAGAACCCACCCAACAGAATAGGCCAGCCCATGCCAG
CCGGCTTGGCCCGCTGCAGGCCTCAGGCAGGCGGGGCCCATGGTTGGTCCCTGCGGTGGGACCGGATCT
GGGCCTGCCTCTGAGAAGCCCTGAGCTACCTTGGGGTCTGGGGTGGGTTTCTGGGAAAGTGCTTCCCCA
GAACTTCCCTGGCTCCTGGCCTGTGAGTGGTGCCACAGGGGCACCCCAGCTGAGCCCCTCACCGGGAAG
GAGGAGACCCCCGTGGGCACGTGTCCACTTTTAATCAGGGGACAGGGCTCTCTAATAAAGCTGCTGGCA
GTGCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016434.4
Locus ID 51750
Summary This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Sep 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.