OriGene Logo

Ferritin Heavy Chain (FTH1) (NM_002032) Human 3' UTR Clone

Be the first to review this product
SKU
SC206188
3' UTR clone of ferritin heavy polypeptide 1 (FTH1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Ferritin Heavy Chain or NM_002032"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Ferritin Heavy Chain
Synonyms FHC; FTH; FTHL6; HFE5; PIG15; PLIF
ACCN NM_002032
Insert Size 472 bp
Sequence Data
Insert Sequence
>SC206188 3’UTR clone of NM_002032
The sequence shown below is from the reference sequence of NM_002032. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCCTGGGAGACAGTGATAATGAAAGCTAAGCCTCGGGCTAATTTCCCCATAGCCGTGGGGTGACTTCC
CTGGTCACCAAGGCAGTGCATGCATGTTGGGGTTTCCTTTACCTTTTCTATAAGTTGTACCAAAACATC
CACTTAAGTTCTTTGATTTGTACCATTCCTTCAAATAAAGAAATTTGGTACCCAGGTGTTGTCTTTGAG
GTCTTGGGATGAATCAGAAATCTATCCAGGCTATCTTCCAGATTCCTTAAGTGCCGTTGTTCAGTTCTA
ATCACACTAATCAAAAAGAAACGAGTATTTGTATTTATTAAACTCATTAGTTTGGGCAGTATACTAAGG
TGTGGCTGTCTTGGATTCAGATAGAACTAAGGGTTCCCGACTCTGAATCCAGAGTCTGAGTTAAATGTT
TCCAATGGTTCAGTCTAGCTTTCACAGTTTTTATGAATAAAAGGCATTAAAGGCTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002032.3
Locus ID 2495
Summary This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.