OriGene Logo

C14orf169 (NM_024644) Human 3' UTR Clone

Be the first to review this product
SKU
SC206168
3' UTR clone of chromosome 14 open reading frame 169 (C14orf169) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "C14orf169 or NM_024644"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol C14orf169
Synonyms C14orf169; hsNO66; JMJD9; MAPJD; NO66; ROX; URLC2
ACCN NM_024644
Insert Size 481 bp
Sequence Data
Insert Sequence
>SC206168 3’UTR clone of NM_024644
The sequence shown below is from the reference sequence of NM_024644. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCACTAAGATGCCTCTAGCCCTAAATTAGTTTCTTGTTGATTGCTGGAAACAAGGCAGTAGTGATTCT
CCGCTGCCACTGCTACCTTTTTTTTTTTTTTTTCCTTAAACTCACGTTCTTACCTTGATAAGCATCAGT
GTGCTCACATTTACCTTTATCACTGCTTCAGTGTCACAAACCTCGGAAGGTCTTCTAGGAAGAACCATC
TCATCTAGGTACAAAAGGAAAAGGAGAAGTTGGAGGTGGAAAAAAAACCCTTGATCCGTGATCATTTCA
GAGCACCAACTTCATCACCTTCAGGCTTCAGTGTACTGGGTAACACTGACCATGTCGTTCTGCTTGAGA
CAGATATTAGATTTTTTTTGGAATTTGGATCTTTCATCTGAGTTCTTTTTCATGGGCGGGTCGGGGTCA
GTATCCTGTTTGTTATTGTTAAATTTGTATGAACCTTAGAAAAGTTATTAAAGTGCCAAAGAATGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024644.5
Locus ID 79697
Summary Oxygenase that can act as both a histone lysine demethylase and a ribosomal histidine hydroxylase. Specifically demethylates 'Lys-4' (H3K4me) and 'Lys-36' (H3K36me) of histone H3, thereby playing a central role in histone code. Preferentially demethylates trimethylated H3 'Lys-4' (H3K4me3) and monomethylated H3 'Lys-4' (H3K4me1) residues, while it has weaker activity for dimethylated H3 'Lys-36' (H3K36me2). Also catalyzes the hydroxylation of 60S ribosomal protein L8 on 'His-216'. Acts as a regulator of osteoblast differentiation via its interaction with SP7/OSX by demethylating H3K4me and H3K36me, thereby inhibiting SP7/OSX-mediated promoter activation (By similarity). May also play a role in ribosome biogenesis and in the replication or remodeling of certain heterochromatic region. Participates in MYC-induced transcriptional activation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.