MYOM1 (NM_003803) Human 3' UTR Clone

SKU
SC206146
3' UTR clone of myomesin 1 185kDa (MYOM1) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MYOM1
Synonyms SKELEMIN
ACCN NM_003803
Insert Size 485 bp
Sequence Data
Insert Sequence
>SC206146 3’UTR clone of NM_003803
The sequence shown below is from the reference sequence of NM_003803. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCTGAAAGGTGGCAAGAAGGCCAAGTGACCGGAGGTGCGAGGAGAGCCAGCCGGCCTGTGTGACTTG
GGTGTGAATGGTTTGGGTTAAGGATGAGACGTCTTCATGCTTTCTCCTCCCTATTATTTTCTGGCTTGA
GGGGAAAATAATGTCAGGTCTTTCACTCATATAAAAAAGCACCAACTAATGACACTTTAATTGTTTTTC
TTTATCTACAAAATTATGTGTTAAGAAAATACCATTCATAGCATGAAGATTAGGAAACAGTTTTAAGGA
GAAGACTTGAATGAAGTTGGAGGGACATTGAATGATGGTCAGAGGGCAGACGAATGTGTCGTGGGGCGA
ATTGGGATTTGCTGCAGCTGTGAAGCCATGGCCGTGTCTCGTGTGTTGTTACAGAGGTGATGTGCTTTT
CGACGGGCGCCTCGTGGCTTGGAACCTCCTCTGTATGAATAAACAGTTTTCACGTCTGTCCTCTTCCCC
GA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003803.4
Locus ID 8736
Summary The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.