PILRB (NM_013440) Human 3' UTR Clone

CAT#: SC206110

3' UTR clone of paired immunoglobin-like type 2 receptor beta (PILRB) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "PILRB"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PILRB
Synonyms FDFACT1; FDFACT2
ACCN NM_013440
Insert Size 482 bp
Sequence Data
>SC206110 3’UTR clone of NM_013440
The sequence shown below is from the reference sequence of NM_013440. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTAGCAGGGCGCCAAGCAGTGACTTCTGACCAACAGAGTGTGGGGAGAAGGGATGTGTATTAGCCCCG
GAGGACGTGATGTGAGACCCGCTTGTGAGTCCTCCACACTCGTTCCCCATTGGCAAGATACATGGAGAG
CACCCTGAGGACCTTTAAAAGGCAAAGCCGCAAGGCAGAAGGAGGCTGGGTCCCTGAATCACCGACTGG
AGGAGAGTTACCTACAAGAGCCTTCATCCAGGAGCATCCACACTGCAATGATATAGGAATGAGGTCTGA
ACTCCACTGAATTAAACCACTGGCATTTGGGGGCTGTTTATTATAGCAGTGCAAAGAGTTCCTTTATCC
TCCCCAAGGATGGAAAAATACAATTTATTTTGCTTACCATACACCCCTTTTCTCCTCGTCCACATTTTC
CAATCTGTATGGTGGCTGTCTTCTATGGCAGAAGGTTTTGGGGAATAAATAGCGTGAAATGCTGCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_013440.3
Summary The paired immunoglobin-like type 2 receptors consist of highly related activating and inhibitory receptors that are involved in the regulation of many aspects of the immune system. The paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This gene encodes the activating member of the receptor pair and contains a truncated cytoplasmic tail relative to its inhibitory counterpart (PILRA), that has a long cytoplasmic tail with immunoreceptor tyrosine-based inhibitory (ITIM) motifs. This gene is thought to have arisen from a duplication of the inhibitory PILRA gene and evolved to acquire its activating function. [provided by RefSeq, Jun 2013]
Locus ID 29990
MW 17.9

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.