ALK (NM_004304) Human 3' UTR Clone

SKU
SC206101
3' UTR clone of anaplastic lymphoma receptor tyrosine kinase (ALK) for miRNA target validation
  $683.00
2 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ALK
Synonyms CD246; NBLST3
ACCN NM_004304
Insert Size 480 bp
Sequence Data
Insert Sequence
>SC206101 3’UTR clone of NM_004304
The sequence shown below is from the reference sequence of NM_004304. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAATAGCATGAACCAGCCTGGGCCCTGAGCTCGGTCGCACACTCACTTCTCTTCCTTGGGATCCCTA
AGACCGTGGAGGAGAGAGAGGCAATGGCTCCTTCACAAACCAGAGACCAAATGTCACGTTTTGTTTTGT
GCCAACCTATTTTGAAGTACCACCAAAAAAGCTGTATTTTGAAAATGCTTTAGAAAGGTTTTGAGCATG
GGTTCATCCTATTCTTTCGAAAGAAGAAAATATCATAAAAATGAGTGATAAATACAAGGCCCAGATGTG
GTTGCATAAGGTTTTTATGCATGTTTGTTGTATACTTCCTTATGCTTCTTTCAAATTGTGTGTGCTCTG
CTTCAATGTAGTCAGAATTAGCTGCTTCTATGTTTCATAGTTGGGGTCATAGATGTTTCCTTGCCTTGT
TGATGTGGACATGAGCCATTTGAGGGGAGAGGGAACGGAAATAAAGGAGTTATTTGTAATGACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004304.5
Locus ID 238
Summary This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).provided by RefSeq, Jan 2011
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.