STAG3 (NM_012447) Human 3' UTR Clone

SKU
SC206099
3' UTR clone of stromal antigen 3 (STAG3) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol STAG3
ACCN NM_012447
Insert Size 396 bp
Sequence Data
Insert Sequence
>SC206099 3’UTR clone of NM_012447
The sequence shown below is from the reference sequence of NM_012447. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTACAGAGCTGGATATTGAGGATTTCTGACAGGACTCTGGGCCCCTCCCCAGCTCCACTCCCTACCTC
AAGAATGTGACCATTTGGAAAAGGCAAAGAGAAAAGGAGCAAAATGAAGCATTCCCCCAGGCTTCAGCC
CTGGGCTCTGAGGGGAAAGAGTTGGGCATTGTTTTTCTAACCTAACCTTTCCCTCTGGGGTAGAGAAGC
CGAGAGACCCTGTCCTCCCTAATGCACTGTGGCCCAGTCCCCTTGCCTTTTTCCTGTTCTGTTTGGAGT
GGAGAAGGGCAGCACCTCTGTGTTTAATGGAAATAGCCCATAGTCTCCTGGATTTTTGGAACATCTTTC
TCAGCCTATTTTGTGTCCTAATGATTCGCTCAATAAACATGTTTGAATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012447.4
Locus ID 10734
Summary The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. provided by RefSeq, Apr 2014
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.