PPP2R3B (NM_013239) Human 3' UTR Clone

SKU
SC206089
3' UTR clone of protein phosphatase 2 (formerly 2A) regulatory subunit B'' beta (PPP2R3B) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PPP2R3B
Synonyms NYREN8; PPP2R3L; PPP2R3LY; PR48; PR70
ACCN NM_013239
Insert Size 464 bp
Sequence Data
Insert Sequence
>SC206089 3’UTR clone of NM_013239
The sequence shown below is from the reference sequence of NM_013239. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCGGGGACGAGGACCTGGAGCCGCTGTGACGCCGCCCGCGAGAACGCCGCCGCGGGGCCGCTCCCCAC
GTGCCACCACCGGGCCACCGCGGCTCGTGTAAAAACTGTTGTGGAAAATGAGTGCGTTTGTACGGAATG
ATAAACTTTTATTTATTCACAGAAGCGTGTTGATTGCCGCTGTGGGTTCGTGGCTGGACCTGCCCAGAG
CTCTGTGCCAGGGGGACACGTAGGGCCGCGCGTGAATGGGACGGGTTCCCACACGGACACCCTCTGGCG
CTTGCCGTTCCCGACCCAGCCTGGGTTCCGGGGCCTGCGTCTGTGGAAAGGGTCCGTGTGCGCACAACG
GTGACCGGCGGCTCCCGGGCGCCTCAGTCCTGGACAGGAGCCTCCACCACAGGCTGTGTGAATGTTTTG
TGTAAACGTACAAAACCGTTTCTGGCGATCACGCTTGTACGTTTGGAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013239.5
Locus ID 28227
Summary Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the beta subfamily of regulatory subunit B''. provided by RefSeq, Apr 2010
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.