OriGene Logo

BAP31 (BCAP31) (NM_005745) Human 3' UTR Clone

Be the first to review this product
SKU
SC206076
3' UTR clone of B-cell receptor-associated protein 31 (BCAP31) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "BAP31 or NM_005745"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BAP31
Synonyms 6C6-AG; BAP31; CDM; DDCH; DXS1357E
ACCN NM_005745
Insert Size 475 bp
Sequence Data
Insert Sequence
>SC206076 3’UTR clone of NM_005745
The sequence shown below is from the reference sequence of NM_005745. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGGTCCCATGGACAAGAAGGAAGAGTAAGGGCCTCCTTCCTCCCCTGCCTGCAGCTGGCTTCCACCT
GGCACGTGCCTGCTGCTTCCTGAGAGCCCGGCCTCTCCCTCCAGTACTTCTGTTTGTGCCCTTCTGCTT
CCCCCATTCCCTTCCACAGCTCATAGCTCGTCATCTCGGCCCTTGTCCACACTCTCCAAGCACATTACA
GGGGACCTGATTGCTACACGTTCAGAATGCGTTTGCTGTCATCCTGCTTGGCCTGGCCAGGCCTGGCAC
AGCCTTGGCTTCCACGCCTGAGCGTGGAGAGCACGAGTTAGTTGTAGTCCGGCTTGCGGTGGGGCTGAC
TTCCTGTTGGTTTGAGCCCCTTTTTGTTTTGCCCTCTGGGTGTTTTCTTTGGTCCCGCAGGAGGGTGGG
TGGAGCAGGTGGACTGGAGTTTCTCTTGAGGGCAATAAAAGTTGTCATGGTGTGTACGTGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005745.8
Locus ID 10134
Summary This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. provided by RefSeq, Jan 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.