CD9 (NM_001769) Human 3' UTR Clone

SKU
SC206058
3' UTR clone of CD9 molecule (CD9) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol CD9
Synonyms BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29
ACCN NM_001769
Insert Size 468 bp
Sequence Data
Insert Sequence
>SC206058 3’UTR clone of NM_001769
The sequence shown below is from the reference sequence of NM_001769. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTATCCGCAGGAACCGCGAGATGGTCTAGAGTCAGCTTACATCCCTGAGCAGGAAAGTTTACCCATGA
AGATTGGTGGGATTTTTTGTTTGTTTGTTTTGTTTTGTTTGTTGTTTGTTGTTTGTTTTTTTGCCACTA
ATTTTAGTATTCATTCTGCATTGCTAGATAAAAGCTGAAGTTACTTTATGTTTGTCTTTTAATGCTTCA
TTCAATATTGACATTTGTAGTTGAGCGGGGGGTTTGGTTTGCTTTGGTTTATATTTTTTCAGTTGTTTG
TTTTTGCTTGTTATATTAAGCAGAAATCCTGCAATGAAAGGTACTATATTTGCTAGACTCTAGACAAGA
TATTGTACATAAAAGAATTTTTTTGTCTTTAAATAGATACAAATGTCTATCAACTTTAATCAAGTTGTA
ACTTATATTGAAGACAATTTGATACATAATAAAAAATTATGACAATGTCCTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001769.4
Locus ID 928
Summary This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.