DACH2 (NM_001139515) Human 3' UTR Clone

SKU
SC206029
3' UTR clone of dachshund homolog 2 (Drosophila) (DACH2) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DACH2
ACCN NM_001139515
Insert Size 477 bp
Sequence Data
Insert Sequence
>SC206029 3’UTR clone of NM_001139515
The sequence shown below is from the reference sequence of NM_001139515. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAATGGCACAACAGTTGTATTCAGCCTGAAAGGTCCTCGCTGGCTTTACATAAATGAAGATGCTTGTG
ATTCCAGTTTATCTCTGAAACTATTCAACATGGAGTTATTTCAGTTTTGTTTATCAGCAAAGCTTTGTT
TACTGAAGGAGCTATTTAATCTATGTTACATTAAAAAAGAAACGCGTGTACATTTTAAAAGCAATGATG
TAAACTTTGTTCTTGCATTAGACTGACCAGTTTAAAAATATGAACTAAAACCTAATGGCTAAAGTAACT
TGACCATATTTGATGCTTTTCTATGCTCATTTCAACTTGGCTTTTTGTCTTTTAAATTTTTAAAAAATG
CAGTAGTGTGTTAGAGACTAGAAAGTTATATGTATGGTTTCCCTGTTCTACTATACATAACGTTAAAGT
ACACCTTCTTTGTTAAAAATGTACTTGCTAAACTTCAGCGTAAATAAAAACATTTTGACTTTG
AGCGGACCGACTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCC
CAACCTGCCATCACGAGATTTCGATTCCACCGCCGC
Restriction Sites SgfI-RsrII |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001139515.1
Locus ID 117154
Summary This gene is one of two genes which encode a protein similar to the Drosophila protein dachshund, a transcription factor involved in cell fate determination in the eye, limb and genital disc of the fly. The encoded protein contains two characteristic dachshund domains: an N-terminal domain responsible for DNA binding and a C-terminal domain responsible for protein-protein interactions. This gene is located on the X chromosome and is subject to inactivation by DNA methylation. The encoded protein may be involved in regulation of organogenesis and myogenesis, and may play a role in premature ovarian failure. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.