MRPL47 (NM_177988) Human 3' UTR Clone

Be the first to review this product
SKU
SC206027
3' UTR clone of mitochondrial ribosomal protein L47 (MRPL47) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "MRPL47 or NM_177988"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MRPL47
Synonyms CGI-204; L47mt; MRP-L47; NCM1
ACCN NM_177988
Insert Size 477 bp
Sequence Data
Insert Sequence
>SC206027 3’UTR clone of NM_177988
The sequence shown below is from the reference sequence of NM_177988. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGAAGCCCAAAAGTCAAGTCTTGTCTAAGATGTCTGAACTATTAAATTTACCATTTTGTTTTTCTTG
AATAGTCTGTGTACAGGAGTAAATATGTTAAGTGGTTTATAAAGAAATTCTGTTTTTAGTCAAGTGACT
TTACTAATCAGTTGTTCTAAGTGTGAATATGGCATGCTAATTAGCTAATTTGGTAGAAGCTAATTTGCT
TCTAAAAATCAGGTATAAAGTTCAGATGAGATTCCCACTTTATAAATTCTGACATTTAAGCAGGCTTTA
AATGTCACCTGCTACCTTAGAGTGTGAAGGTGATGGTAACTGCCACAGCAAAGGCAATACCGTAGTTTT
TGAATTTGAATAATAGTTTTACCTCTGTTGTTAATAGGCTATGAAGAGGATGTGGGTATTGCTGTTAAT
AAACGGAGGACTTTGATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_177988.1
Locus ID 57129
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene is immediately adjacent to the gene for BAF complex 53 kDa subunit protein a (BAF53a), in a tail-to-tail orientation. Two transcript variants encoding different protein isoforms have been identified. [provided by RefSeq, Jul 2008]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.