DDX47 (NM_201224) Human 3' UTR Clone

SKU
SC206016
3' UTR clone of DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (DDX47) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DDX47
Synonyms E4-DBP; HQ0256; MSTP162; RRP3
ACCN NM_201224
Insert Size 457 bp
Sequence Data
Insert Sequence
>SC206016 3’UTR clone of NM_201224
The sequence shown below is from the reference sequence of NM_201224. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAAAAATGAAGAAGCGGAAAGGCCGTTAATCACTTTTATGAAGGCTCGAGTTCTGCTGTTCTGTAAAA
GAGAATTGGAGAATGAAACCTGCTCCAACAGAGATCATGAGACTGAAATTGGTCAGAATTGTGTCCAGA
ATGTGCTCAGCTAATTCAGTATTCTTCCCCATTCTGGGTTGGAGTTTACTGCAGAGTAATTCTTACAGT
GCTGATGTCAAGACTGTTACTGTTCTTCGACTTTGATTCCTTGCTCATGACATGAGTAGGGTGTGCTCT
TCTGTCACTTCACACAGACCTTTTGCCTTTTTTAGCTGCAAGTCAAGGACTAGGTTGATGATGCCCATG
ACCTGTAATTGTAAAGAAGCTTGGACATCTGCAAATGATATTTAAACCATCTTGGCTTGTGCTTTATTC
AAACTAATGTGAAACAATAAATTTAAATATTATTTTTAAAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_201224.2
Locus ID 51202
Summary This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.