OriGene Logo

RNMTL1 (MRM3) (NM_018146) Human 3' UTR Clone

Be the first to review this product
SKU
SC206010
3' UTR clone of RNA methyltransferase like 1 (RNMTL1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "RNMTL1 or NM_018146"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RNMTL1
Synonyms RMTL1; RNMTL1
ACCN NM_018146
Insert Size 470 bp
Sequence Data
Insert Sequence
>SC206010 3’UTR clone of NM_018146
The sequence shown below is from the reference sequence of NM_018146. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTTGAGCAGGGACAGGAGTTACCACTGAGGACGCAGAAGTGACTTCTGCTTGAGGACGTCTGCAGCT
CCTCCTACACCAGCACACTGGTGGGAGGCTGGCGGAGTCAGTGACTATGGCCCCCACGTTCAGGAGGAA
GGTGTGATGCCGTCATACAGTTACAGGAAAAATAAGAACTTCCTCAGAAAGAACAGGTCCGAATTCTTC
CTGTCGCGTCACTGATTTTGAGGTTCTTTTTTCTCTTGGTGACAATAGGTGACCCACGTGGCTCTGTGT
GTTTTTAAAAATTGTCCACCAAGAAGCACTTTGTGCCCAGAAAGTTCCTGAAGCATCATCCTGGCAGGG
AGGCGCCTGCTCCACCAGCTGGTGGGTGTTTGTAATCGCCAAGCACCAGCTATAGGTCACAGCCACATC
ACTCACAGCTGATCACTGGTTGGTGGAAAATAAACTATGAGCAGCAGATTACGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018146.4
Locus ID 55178
Summary Efficient translation of mitochondrial-derived transcripts requires proper assembly of the large subunit of the mitochondrial ribosome. Central to the biogenesis of this large subunit is the A-loop of mitochondrial 16S rRNA, which is modified by three rRNA methyltransferases located near mtDNA nucleoids. The protein encoded by this gene methylates G(1370) of 16S rRNA, and this modification is necessary for proper ribosomal large subnit assembly. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Dec 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.