GCDH (NM_000159) Human 3' UTR Clone

SKU
SC206001
3' UTR clone of glutaryl-Coenzyme A dehydrogenase (GCDH) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GCDH
Synonyms ACAD5; GCD
ACCN NM_000159
Insert Size 488 bp
Sequence Data
Insert Sequence
>SC206001 3’UTR clone of NM_000159
The sequence shown below is from the reference sequence of NM_000159. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAATCCAGGCGTTCACGGCCAGCAAGTGAGCCGCTCCATCAGGGGCCCGAAACTCTCAAGCCCCTTTC
TGGAGAGATGCCTGGCTGGACCGTAGGAGCGCTGTGCTCTGAGCTTAGAAAGGGAGGTGGCGGATGGAG
TGGGAAGTGAGAGACACTGATTTTTAAATATCAAAATTTCCCTTCTGAAGTCGTTCAGATGTGTTCCTT
AAAAAGAAGATGGAATTCTCTGTAGAGCGTCTCAATCCACTTTTAACCATGGATGAGAGCAGACTCCAT
TTACCCTGAAATAGCAGCTTCTCTTGAGAGGAGAGTGACATGGAAGCAACTCCGTCTGCTGCAGCTGAC
CCCCTCACACTGAGTTCACAGTGCGCCCTCCCTCCCTCCCATCTGGGGGTAGTGCCTTATGCTGGGTGT
TGGAGCAGAGTGAGGGAGAGGAAAATAAAGACCTGCACATCTGACCCCAAGGTGTCAGGCCGGTTTACT
GGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000159.4
Locus ID 2639
Summary The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.