BAF53A (ACTL6A) (NM_178042) Human 3' UTR Clone

SKU
SC205996
3' UTR clone of actin-like 6A (ACTL6A) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BAF53A
Synonyms ACTL6; Arp4; ARPN-BETA; BAF53A; INO80K
ACCN NM_178042
Insert Size 445 bp
Sequence Data
Insert Sequence
>SC205996 3' UTR clone of NM_178042
The sequence shown below is from the reference sequence of NM_178042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAAGGAGGGAAGCAGTGTGTAGAAAGAAAATGCCCTTGAGAAAGAGTTCCCAAGCTTCTACCTTCCTT
TTGTCACCTTACGTTTCATAGCTTTAGTATACTCAGGAAAAGAATGACCATCTTTTGTAGAATGTTTATA
CATTTTTGCATATTTCAATTTCCACTTAAATTTTTTAAAGCTTTAACTGGCTCTATAAATTAAGTTTGTG
CTTTCCTTGAAATGCACTTATTCTTATTACAAGCATTTTATAATTTTGTATAAATGTCTATTTTCTCTAA
ATATTTTGCTTTCAGTAAAATGCTTTCCAACTCTGTTTAGTGTATTAATTACCAGTGGATTGGTAGAACT
GCTTTTTATTGACTAGTAAAAGTTACTGCCTATGCTTTTTACCTTAGGCTTACAGAATTAAATAAAAATT
AGCCATTCCAGAAATAAAAAAAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178042.2
Locus ID 86
Summary This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.